.

I mina bästa dar, aldrig mått så bra som kännslan, ja fick när jag blitt av med dig!
ttyn



if only I could read your mind.

-or you could just say what's on them

sweet

Bion vart som sagt inställd, så nu har jag precis kommit hem igen, och sitter och fotar mig själv..
- det får mig alltid på så mycket bättre humör!

Mobilblogg /Mette

Bion vi skulle se vart inställd, så vi sitter på bussen påväg hem igen och lyssnar på en massa remixar på "tonight gonne be à good night" och äter godis för att inte deppa ihop helt och hållet :)


17:26

hej på er! snart så kommer Nicklas förbi, vi ska gå på bio tonight :) mysigt!! ingen aning om vad vi ska se ens, men hoppas det har kommit ut någon ny skräckis, men Nicklas lär ju inte vilja se någon skräckis eftersom han är lite små feg när det gäller sånt ;)

!"#€%&/()(/&%€#"!"#€%&

ursäkta mig nu, men jag blir så jävla trött!!! jag kände på mig att jag glömt någonting när jag åkte från skolan, tror ni inte att jag glömde min jävla väskjävel?! JO! det är bara att åka tillbaka till skolan och hämta den, kul.
50 minuter dit och sen hem igen! jippi.
En riktigt snygg bild.

new

Juste fick med mig denna hem igår, är så kallat "torr schampo" har aldrig provat det tidigare, men jag tänkte give it a chance, någon som provat? va tycker ni? funkar det? -tell me!

idag

Hej på er, ska som sagt alldeles strax börja rulla in mot staden, för att kolla lite i affärerna, äta middag och slutligen gå på bio, ska bli hur mysigt som hälst, och så här ser jag ut!

Wakman här

Fixade mina naglar igår, använde mig av glitter :) fint vaa? Älskar orange nu till höst!


sova

Hej på er, vaknade av en asknasig anledning redan nu, och kan absolut inte somna om igen -.-
Ska försöka sova lite till, hör av mig sedan!

6:53

time for school bitches.

a new favorite

Detta blir nog mitt sista inlägg för ikväll! Ni fick ett riktigt bra avslut må jag säga! ruggigt bra musik;)
vi hörs imorgon mina babes.
kisses

enlitenbildbarasådär


myssa litte

ligger och snackar med Mettsson på skype, lite små mysigt sådär! ska snart sätta på filmen ratatouille och äta lite :)
köpte faktiskt lite riskakor idag! det var typ 10 år sen jag käkade dom kakisarna :D
Brevid dom så serveras det grönt te! muhu.

bilder!!!!


fika

Hej på er, kom precis hem från jobbet och är helt slut, som tur är e jag ledig imorgon, så jag får vila ut ordentligt.. Har bokat in bio med en tjej i klassen, och så ska vi äta lite bufee ogrejjer! SUPER!
Bilder från dagen då jag var på fika med Angelica, som jag inte träffat på år och dagar känns det som! :)


/waka waka ey ey

hej där! jag undrar en liten,lite sak: VARFÖR GÅR DET INTE ATT LADDA UPP BILDER?! har precis lagt över alla bilder från i onsdags till datan och då blir det såklart såhär?! Trött jag blir!

Kul

Vart så att säga lagom glad när detta sms anlände imorse


så är det

Hej på er, förlåtförlåtförlåt, men kom hem så att jag hade precis 20 minuter på mig att byta om innan jag var tvungen att dra på träning -.- suger, i know.. Men nu är jag äntligen hemma, och tänkte gå och lägga mig är HELT slut! Vi hörs senare!
Hej på er, förlåtförlåtförlåt, men kom hem så att jag hade precis 20 minuter på mig att byta om innan jag var tvungen att dra på träning -.- suger, i know.. Men nu är jag äntligen hemma, och tänkte gå och lägga mig är HELT slut! Vi hörs senare!

Wakman här

Sitter på Östermalms torg och väntar på Molly som praktiserar här:) sedan drar vi oss mot Slussen för att möta Mette som har mitt smink och min kamera(vilket är sjukt viktigt tills ikväll) sedan åker jag och mollsan hem till henne för att fixa oss och käka sushi;)


Just nu!

Har precis lagt mig i badet! Hur skönt som helst ;) sterion är på och ansiktsmasken är på! :) i morgon ska jag ju som sagt på ett event med min bästaste Molly! Så bilder på det kommer upp imorgon :D
// wakman


söta

såhär sitter vi på lektionen! I LOVE MAC <3


den mörka sanningen

Hej på er, har precis legat på golvet i lillsyrrans rum och fotat mig själv, här har ni litet resultat.

bloggen

Sitter just nu och fixar iordning bloggen samtidigt som jag skypar med Wakman. Vi har en massa nya planer för bloggen, åh ni kommer att älska det! Kommer ta ett litet tag innan ni märker av det, men när ni väl gjort det, JAG SVÄR det kommer blir skillnad!

hej mina finisar

vad har ni för er? -jag kom precis hem från en underbar shoppingrunda med min mamma! tänkte slänga in lite bilder på allt lite senare om jag hittar någon annan kamera eftersom min babe är hemma hos mettsson! :(

.


Dagens

- Mörkblå jeans
- Vit Blus
- Flätor

väldigt enkelt



music




hey

Hey på er alle sötnosar! Sitter i skolan och har datakunskap, det suger! Men snart är det efterlängtad lunch så jag får hålla ut helt enkelt. Har inte så mycket mer att tala om för er just nu, hör av mig mer när jag kommer hem!




ångest

Då var det dags att börja göra sig iordning för att kila iväg till djurös sporthall och jobba -.- Nej men det ska blir kul faktiskt! :) Efter jobbet kilar jag över till salen bredvid och kör lite "kärringympa" denna vecka också, underbart!

födelsedagskalas

Eftersom varken jag eller Wakman fick med oss våra kameror, så blir jag tvungen att låna från facebook, där jag hittat ett fåtal bilder från lördagens roligheter!
Tack ännu en gång Felix, för ett otroligt skönt födelsedagsfirande, och för att vi fick komma!
Här har ni en bild på hjälten!

idag

Solglajjor + Kängor.
Ni får ursäkta dåliga bilder men som ni vet så har kameran inte kommit tillbaka ännu..

SV:

Ebbaom work:
Hejhej jätte fin blogg ni har! :D 
En fråga vart jobbar du wakman? Eller vad jobbar du med? Hihi :D

Sv: tack,tack och tack!! :D hehe, jag har inget jobb ÄN! jag har lovat mig själv att leta efter något extra jobb faktiskt. jag jobbade inte ens i sommar.. haha.



home

Jag är tröttast i hela världen, och håller på att städa på mitt rum (som vanligt) hör av mig senare, om gårkvällen osv nu måste jag fortsätta!

fekkenation

VI DRAR

sådeså

E så snygg så jag inte kan sluta fota mig själv, här kommer en till egobild!

cepe taggad

Yes, nu börjar jag bli klart. Ska väll om någon timme börja rulla mot partajjet VI HÖRS!

tänker

Vad fan ska jag ha för skor...

fest

JÄVLAR VA TAGGAD JA E, jobbtimmarna känner jag dock kommer ta ÅR eftersom jag e så taggad till kvällen!

work

nu åker jag! vi hörs vid 5 igen! kisses

nattinatti

Har precis badat och fixat mina naglar! hehe, kortspel.. coolt huh?

trött

Ska krypa till kojjs nu, är astrött och imorgon ska jag upp tidigt för att åka och jobba, sedan äre kalas för heeela jävla slanten! PUSS

HEY

Hej på er, har lite små grejjer jag borde fota och visa er, som jag köpte idag inför morgondagen, då vi ska på RÖKARFEST fyfan va najs de kommer bli, SJUKT vad taggaaaad jag är! Men eftersom min kamera e cepe, så kanske jag får visa er imrogon helt enkelt, får se om jag hinner ikväll. puss så länge!

trött, jobb imorgon!

hejhopp! är faktiskt hur trött som helst today :/ ska ta det lugnt idag, kanske träffa mette?-gud vad jag saknar henne! Vi båda ska ju som sagt jobba imorgon.. Men jag är faktiskt ganska taggad inför mitt lilla jobb, man kanske inte ens kan kalla det ett jobb eftersom jag inte får pengar för det(?) men anyway så ska det bli rätt kul ;)


gonatt

Nu ni är jag så jävla trött att jag bara ska slänga mig i sängen och soooova.. fast först måste jag
*Fläta mitt hår
*Ta bort mitt smink
*Smörja in mig
-Antirynk (kväll) i pannan
-Anti påsar under ögonen
-Body lotion
-Samt ett antal "håll ditt hår fräsch/tickerfuller hair" produkter!
Älskar att vara naturligt vacker!



miss you

Saknar ni oss? Vi saknar faktiskt er också, tro det eller ej! Menmen vi har som sagt inte haft tid, och jag tror faktiskt att vi kommer ha ännu mindre tid imorgon, och ÄNNU mindre tid än de, om de nu går dagen efter de då vi ska på RÖKASKALAS! :D HAHA mer om de får ni veta när vi väl har tid haha! :) HÖRS

upptagen

Förlåt, men jag har inte haft tid med er en sekund idag.. SEGT för er. Har inte tid för er nu heller men vi hörs allesammans! PUSS

trött

Ligger i soffan och försöker ge mig själv energi till att hoppa in i duschen, är verkligen helt slut!

HAHAHA!

Vart så nöjd att jag bara är tvungen att visa er allesammans!
"vågar ni utmana mig"?

18:27

hej vänner! har precis övat in lite sminkningar på mig själv tills på lördag, hehe. Men iallafall så blev det inget event med molly i veckan, det blir nästa onsdag istället! så jag har lite mer tid på mig att fundera över vad jag ska ha på mig :)

dagens


on my way

Ska åka mot gustavsberg nu för att fixa lite personliga ärenden hehe, nu vart ni nyfikna va! ;)
Hörs senare helt enkelt!

ey

hallå! kom precis hem med en vrålhungrig mage, så jag ska precis fixa lite food och lägga mig framför en film!

träning & hälsa

Hej på er, ligger i sängen och kollar igenom lite bloggar, och tänkte att bestämma mig för att nu JÄVLAR ska jag se till att lösa det här med min vikt, (inte för att jag är överviktig på någe vid) vill inte heller bli superskinny, men jag vill bli lite mera "hälsosam" så nu tillsammans med er, tänkte jag ta tillfälle till akt. kommer behöva er är ni med mig?

* Nyttigt, nyttigt och nyttigt!
* Jag kommer behöva ha någon dag i veckan då det är okej att onytta sig, (och då kommer jag vara rejält onyttig)

* Träna, har redan innebandyn, och har precis "börjat" på något vi här ute kallar "kärringgympa" har efter den träningen träningverk jag inte trodde fanns, haha!

Iallafall, jag börjar nu idag, och kommer troligtvis ha min onyttiga dag på lördagar O:), och ni som vill hänga på, why not?! Jag kommer lägga upp alla mina tips på vad jag äter för nyttigheter, och vad jag gör för träning under kategorin "träning och hälsa" så det är bara hänga med allesammans!

( DETTA KOMMER INTE PÅVERKA MITT FESTANDE, NÄR JA FESTAR DÅ FESTAR JAG )





tierd..

sådär, då var det bara att sätta sig i bilen :(

KÖTTätande

VET NI VAD?!

Min mamma kom hem med en "köttätande" blomma för ett par dagar sedan, den är verkligen ASläskig, haha stoppar man in ett finger i blomman, stängs den igen, bom bom bom booooom!

vi e bra

Vi skulle kunna vara jordens nördigaste familj, haha! Ligger allihopa på golvet i vardagsrummet, och spelar ?alfapet? haha eftersom hela familjen blitt "beroende" av "wordfeud" så ah, nu tänkte vi köra en match, på riktigt!

idoltittande

Nu börjar idol! känner att jag behöver uppdatera mig i programmet eftersom jag inte sett det på ett tag nu, hehe.
hörs sen babbas!
p.s håret blev skit bra* :)

omg

Hur in i helv*tes snygga är dom inte? sjuukt coola! älskar dom grovt!


tar ett bad

Står här och funderar på vad jag ska göra, (plugga..., bada, plugga..., bada) Lutar åt badet, vi hörs sen!

färga håret

kom precis hem skönt nog! köpte faktiskt lite färg med mig hem så jag kan färga min brutala utväxt, hehe:) Så nu ska jag blanda ihop färgen och sätta fart. Vi hörs sen, kisses

home sweet home

Jag har precis kommit hem från skolan, ASskönt! Tänkte sätta mig och plugga en stund eftersom jag har en hel del jag måste lämna in denna vecka -.- Imorgon blir det dock ingen skola för mig eftersom jag ska till tandläkarn! Vet dock inte vilken tid, men det får jag väll försöka ta reda på!

från wakis

Gud, ni måste vara SÅ avundsjuka på mig som har Wakman som bästaste bästa vän, kolla var jag fick av henne för ett litet tag sedan! :)) Får så mycke fina grejjer av henne!
wakman e best



nejtack!

Ni vet väl att Britney spears ska ha konsert snart? jag var där förra gången hon var i Sverige och jag säger bara . Det var den värsta konserten jag vart på i hela mitt liv.

1. Hon mimade. (förutom den sista låten och då lät hon som ett fyllo som sjöng karaoke på viking line)
2. Hon åkte runt på en kärra med en stång på och trodde hon var sexig.
3. Hon "fångade" verkligen inte publiken.
Det ända som var jävligt bra var cirkusen som uppträdde innan hon kom in och förstörde allting. Det var riktigt häftigt!
Så.. Om ni vill se Britney spears, jag lovar er! hon kommer suga!

SV:


JM.
om 12:41:
Vad använder du för program till den första bilden?
SUPER BRA BLOGG BTW!

SV:Hej du! Jag och mette använder oss utav en massa olika program, men sidan som jag använt för den där bilden heter pizap :)


Vad var det jag sa?

Grattis Djurgårn! :D


historia, hehe

godmorgon! sitter på Historialektionen och är redan klar med min uppgift (duktig tjej) Vi fick en uppgift där vi skulle skriva om "våran historia" alltså vad som hände året vi föddes osv.

  • Jag föddes en söndag då det var halvmåne.
  • Namnet Amanda betyder "värd att älska".
  • Jag har levt i precis 6246 dagar, 539.654.400 sekunder, 8.994.240 minuter, 149 timmar och 892 veckor!
lät inte 892 veckor jätte lite..

bom bom bom

vem är hon....

Lördag!

på lördag så ska jag och några andra tjejer sminka+fixa håret på några från en musikal som har 20-års jubileum! kul va? det ända problemet är att vi måste upp vid 9 på morgonen och lägg märke till att det är en lördag! aaja! :)

hm..

hej pojkar och flickor! ligger och funderar över vad jag ska ha på mig på onsdag då jag ska följa med Molly på ett event. Ska bli grymt kul :D man vill ju inte vara för "finklädd" liksom, funderar på att ta ett par snygga jeans, ett snyggt linne+ skinnjacka och fokusera på skorna! älskar när man har lite " för snygga" skor och allt annat är bara vardagligt. SJUKT SNYGGT!

hooligan

Idag när jag kom hem så blev jag så lycklig över att Nicklas fortfarande låg kvar i sängen (trodde han skulle hem)! men jag blev ju förstås super glad över att jag fick tillbringa 25 minuter extra med honom, för sen skulle han på AIK match! AIK möter djurgården;) såklart så kommer djurgården att vinna, sorry Nicklas :(
jag förra året med grabbarna!

happyhappy!

fleuree!!

Ni bara måste gå in och kika in på hennes otroligt fina bilder!

hur snygga som helst!

här får du en feeeeeeeeeetläääääääääänk!

 


-.-

Det här var ju kul att vakna till -.-
(det är kameran dåra, som jag blitt tvungen att lämna in)
ni alltså lida med mobil bilder ett tag till..



regn

Tuuudelu, nu kommer ni alla bah "ääääntligen" eftersom det är Mette som e tillbaka hehe! Har faktiskt precis vaknat.. Skiter i skolan idag, (jag har studiedag) hehe! Här kommer ett par bilder från gårdagens lunch då mammsen bjöd mig på resturang J, i sickla underbart!

hello!

my love kom över hit istället, vi kollade på alice i underlandet, käkade osv :)

vi kör dagens blogg istället för veckans

sagahelena!!!

gå in och kika på hennes fina blogg!!!!

:D

 

 


13:47

hallå! vaknade för en stund sen:) ska snart hoppa in i en dusch och åka mot Nicklas! Sover förmodligen där också eftersom jag börjar rätt sent imorgon :D

vaken

Hej på er, vaknade precis, och ska om en liten stund börja göra mig iordning för att åka till jobbet.. suger men thats life.. jobbar bara tre timmar och femton minuter idag, så ja lär hinna blogga  när jag kommer hem! :))

wow..

hittade den här videon på en blogg nyss, har aldrig vart så insatt i twilight men den här filmen verkar sjukt bra :o
kommer ut i november eller vad det stod :o

F.rillan

har precis gjort klart mitt hår för att gå till affären, så jävla sjukt snyggt det blev med luggen! visst?! kände att posen jag gjorde blev fett snygg också.
I LOVE ME

jag undrar

Hej på er, säger bara förlåtförlåtförlåt, för dagens värdelösa uppdatering, som tur är har Wakman bloggar super mycket, så jävla underbar! :)))

:)


Anonym
om I love Pink:
Vart har du köpt den rosa tröjan?
Jag har köpt den på Gina tricot för typ 2 år sen, så tror inte den finns kvar... Men min kompis har nästan en likadan som är från JC :thumbup:

TACK!!



Anonym
om I love Pink:
Ditt hår är helt underbart!!! Vad använder du för shampoo?

Sv: åh tack, vad glad jag blir! :D jag använder inte någon speciellt shampoo/balsam, men mina favorit märken (och dom som jag använder mest) är:
här är mina absoluta favortier! 1. Bed head. 2. Miracle moist. 3. waterclouds.
Men om ni inte gillar att spendera mycket pengar på hårprudukter så tycker jag ni ska testa Tressemmé :)



hey

Ligger och kollar på Ronja Rövardotter, hur gullig som helst! :D Jag älskar alla dom där Astrid Lindgren, disney, pixar filmerna! dom är så sjukt bra. När jag flyttar hemifrån ska jag köpa ALLA dom filmerna :rolleyes:!

I love Pink

Myskläderna! rosa ofc..

dreams

Tänk att få gå på sensation white eller black.. Hur jävla sjukt skulle inte det vara?
Dom kanske ska komma till stockholm den 25e augusti 2012, och då har jag precis fyllt 18 vilket betyder att jag kommer in! wiho!! gilla deras sida på facebook!

12:41

jag är verkligen sugen på att färga mitt hår! Kanske blir något sånt här framåt vintern?

ge mig!!!


hur snyggt är inte det här? vad kan man kalla det... axelsmycke?

hallåååå

hej på er! igår så träffade jag på Sanne på bussen och tog sällskap med henne mot staden. Sedan mötte vi Fanny som åkte med mig hem mot pappa, sanne åkte vidare på party såklart ;)
sånt här onyttigt käkade vi såklart sen när vi kom hem!

men ja?




Anonym om för er som undrar:
Känd? Vart då?
Hahahahaha.
Är det sant att wakman har kallat dig fet?
hmmmm, vart jag är känd.. mäst i stjärten om jag får gissa, någon som hör mer om någon ananstans på mig får gärna säga till thihi.. Och JA men självklart? DAGLIGEN, vem kallar mig inte tjock, och vem kallar inte DIG tjock! :) thihi ledsen tjockis! hoppas du inte tog åt dig!




hos lisa!

Tudelu, allesammans! Sitter hos Alicia och väntar på mat, ska bli ASGOTT är så jävla hungrig haha, förlåt men det blir nog inte så mycket mer bloggning än så här är jag rädd, om jag inte åker hem ?ikväll? men varför skulle jag göra de liksom haha ;), Vi hörs senare PUSSPUSSPUSS PÅ ER!
Jag och Alicia, right fucking now, TAGGATAGGATAGGATAGGATAGGA!
(lägg märke till mitt linne!)

17:56

Har ju som sagt varit med molly sen torsdags eftersom hon inte fått sin lägenhet än (som hon får nästa vecka). Så hon har slaggat hos mig, vi går alltid och köpter chips,dipp och godis när vi är med varandra, Precis som jag och mette gör... hehe. vilket inte är så bra eftersom jag har lovat mig själv att sluta med det där, men ni märker ju hur det går. Jag blir så arg på mig själv! :mad:.

17:30

hejhopp! kom precis hem till värmdö och nu fungerar bloggen som den ska:) Jag kommer aldrig in på bloggen på min pappas data?! Snart så åker jag in mot staden igen för att träffa min underbara Fanny! får se om vi orkar hitta på något, annars så stannar vi bara hemma och myser:)

home sweet home

Sitter och lyssnar på Justin Bieber, och njuter av livet..
Ska om ett tag ut och knata lite med Jennie, sedan till ica och handla efterlängtade onyttigheter, sen djurös sporthall och kolla innebandy, superkul! Hörs sen

min framtid

Hur är ni när ni tror att ingen ser er?

Jag är helt klart popstjärna, gift med Justin Bieber, topmodel och allt i ett och samma svep. Hårborsten är såklart mikrofonen, osv osv.. Helt underbart egentligen att man kan drömma sig bort på de viset, (som iallafall jag gör haha)





dagens

Så här ser jag ut, rätt nöjd med mig själv.. like always! Hörs senare!

yeyeye


jag undrar

Nu är det så att jag undrar, hur många av er läsare som känner mig och wakman, alltså hur många är det som har träffat och brukar "umgås" med oss, antagligen lättare att fråga så än att fråga hur många som inte känner oss, har ju en del läsare nu osv!




för er som undrar

Bella om Mc donken!:
Vadå jobbar du på donken? :) Hur är de isf?
Yes, jag jobbar på donken! Det är kul så länge man jobbar med "rätt gäng" (då alla är glada och trevliga). Det är en bra merit att ha i sitt CV, då man ska söka nya jobb och utmaningar, dessutom behöver jag lite extra pengar sådär, (tills ja blivit tillräckligt känd så att säga) så why not Donken ;)

fest

Som sagt, nu är jag glad igen, och lever livet som om det vore fest.. ?det är en fest? Hörs imorgon PUSS!

!"#€%&/()

Jag skulle vilja färga håret svart och bara sätta mig och hata någonstans. och det är inte likt mig, jag är jordens mest kärleksfulla egentligen och kommer om någon timme ångra att jag ens skrivit det här, men ibland bara måste jag!

tpl? -ja

Vart så jävla arg precis, ARG ARG ARG, verkligen FÖRBANNAD! "galet trött på livet vart jag"
har hamnat i någe sådant där kännsligt mode ni vet, när det känns som att hela världen är
emot dig, samtidigt som jag bara hatar hela världen ÄCKELHUVUDEN!

helt slut

asså jag är ledsen, men jag är så jävla trött så jag går fanimej och lägger mig nu, lovar er bättre uppdatering imorgon, nu ska jag SOVA, har som sagt både vart i skolan och jobbar.. fyfan!

Mc donken!

Hej på er, nu har jag precis kommit hem från jobbet därför jag inte hunnit blogga. först skola sen jobb -.- Jajja, tänkte alldeles strax gå och lägga mig, ska bara ner och ta en macka!

ingen blogg

sorry! men har haft fullt upp hela dagen, har knappt varit hemma :( Nu sitter jag här med molly och ska kika på en mysig film :) vi hörsen senare!

frulle

Här har ni då en typisk frulle alá Mette,
* FULLkorns välling
* 1 Ägg
* Banan (den tar jag med mig om jag blir hungrig under dagen)

sovmorgon

Precis fönat håret och satt på mig lite kläder, tänkte strax springa ner och koka lite ägg, som är bra för att hålla sig mätt under en längre stund, kommer strax, (lär sätta upp håret och dra på mig en usa tröjja innan ja drar) hinner troligtvis visa er PUSS SÅ LÄNGE!

en till :D

Allan nadir!!!!!!
adda han på facebook ! :D då blir han överlycklig!!

SV:

Felix you know who.. om music:
Måste tyvärr faktiskt rätta dig och säga att detta INTE är Sebastian Ingrosso! Utan Steve Angello :P

Peace!
Sv: ja du, det är det säkert! detta är INTE jag som gjort själva youtubeklippet och skrivit Sebastian Ingrosso...
så mig behöver du inte rätta! ;)

KOM IGEN NU KATTEN

Sitter och sörjer lite att min kamera är på lagning, men ska inte säcka ihop för de.. Ska va glad att jag hittade försäkrningen! BTW, SÅ JÄVLA KUL ATT DET ÄR SÅ MÅNGA SOM LÄSER NU, se bara till att kommentera mer, så kommer jag och Wakman om inte lång tid få skriva aoutografer, vore asum!

grupptryck

haha okejokej, jag laddade för bara några sekunder sedan ner det där jävla spelet (endast för att alla snackar om det) why not give it a chace liksom.. iallafall, är ni sugna adda meette, jag suger men kan va kul om ni vill vinna haha! :)

18:03

idag efter skolan så åkte jag och fika med Molly. Vi satte oss på Le Café (vilket jag tycker är världens mysigaste café) iallafall så kollade vi runt på lite resor, vi ska förmodligen åka till Magaluf nästa sommar med typ 10 stycken till men kommer absolut åka någonstans innan också! man kan ju inte vara i Sverige hela tiden? :S
men,men! jag och molly satt och kollade hotell och allt redan nu, haha.

födelsedagspresenter

Liten grejj jag fick i födelsedagspresent som jag glömt visa er alla.. as grymt taggad, ett tag kvar dock, men de ska blir ASnice! :) någon mer som ska gå?
Fick även denna underbara grejj som pryder min vägg i rummet oerhört fint!

kameraLÖS

Kameran kommer vara ifrån mig i 2-3 veckor.. vet inte alls hur jag ska klara mig, men jag har inte någe val helt enkelt.. Undertiden får ni lida med lite webcam bilder från min del! ;)
Men de är ju bättre än inget aight?!

.

Om vi säger så här, en människa som förstör mellan två andra människor borde inte finnas, åk bara hem.
Nu ska jag söka hjälp hos jonathan, puss.
så här känner jag just nu. ska också göra en video

music


fett glad

all slags päls till vintern/hösten! så sjukt snyggt! jag vill köpa mig en väst som jag sett på SALT. grrrr
I love mine

Jag vill också hissa charterparty.se !
jag vill ge Gunilla i hollywoodfruar en FET diss! jag ogillar verkligen henne... helt sjukt.
såg ni förra avsnittet?!

vad tycker ni?

HAHAH satt och kollade igenom en massa bilder jag dör, vad säger ni? då vs nu?











Herregud det är tur att man blir snyggare med åren, eller vad säger ni?



wunderbara läsare






acebook, vet inte om ni sett de, men jag har lagt in en liten facebook like knapp!! :))) Så nu hoppas ja att ni alla är inne och likar alla våra inlägg nu! Så vi kan se vilka trogna fans vi har! :D


wiiiiiiie

Hej på er allesammans, försök behärska er nu vet att ni kommer bli lika lyckliga som jag vart..
ska idag efter skolan åka och lämna in min kamera på lagning, BRA VA?!




vb

red riding hood killen! (vad han nu heter)
shit. se den filmen! sjukt jävla bra!

SV:

Sofia om rödluvan:
Vart är den köpt någonstans? Hur snygg som helst!

Tack! den är faktiskt från gina :D



rödluvan


tack fina du

Ludde om hår:
Du ser jättefin ut i håret =)

Tack, det värmer verkligen! :)

godnatt

Det börjar närma sig läggdags för min del.. det suger, för jag vill inte sova, de är otroligtskönt men det känns som jag missar en massa dyrbar tid om ni förstår!
Börjar lessna på att jag inte har någon kamera, mår verkligen dåligt av att den inte funkar.. Den är liksom en del av mitt liv, vet inte vad ja ska ta mig till utan den.. Ni får helt enkelt leva med sådana här tråkiga bilder ett tag, sry!

gunga gungstol

Satt och njöt av solen på balkongen igår, medans Thea kom och smygfota lite.. Kommer verkligen sakna denna sommarvärme, vill inte inte inte att kylan ska komma, allt har gott så fort, men det är väll bara att leva med!
för vad ska man göra?



hår

Kom precis hem från djurös sporthall där vårt hj lag haft innebandy match mot nått lag, hehe..
btw, kolla in denna bild på hur fint mitt nya hår är,  vet att kvaliten på bilder suger, men kolla.. jävlar va snyggt de e ! :)

hair

såhär blev mitt hår! man ser inte så bra men det blev riktigt bra!!

jag er hunkrik

ska snart hoppa ner i ett varmt bad för att testa min nya hårinpackning och sen min nya vågtäng eller vad det heter :D åh vad kul! men först ska jag äta, är hur hungrig som helst! blev ju som vanligt äcklig mat i skolan, idag såg maten ut som små bruna skrynkliga snoppar/bajskorvar och det låter ju inte så lockande, eller?

dagens:

Shopping!!
1. hårinpackning från Sachajuan 135:-
2. Artist wavemaker 400:-
3. puderborste från bamboo 150:- (?)
mineralpuder kommer inte ihåg men runt 200:- kanske.
Paul frank läppbalsam 50:-
Allt är från Åhléns city!


work..

Nu kilar jag iväg till jobbet, vi hörs senare PUSS

precis just nu



Sitter i skolan och har datakunskap för tillfället, skit tråkigt.. :) Här har ni supersöt bild på mig och trey precis just nu..


trött på livet just nu

är en timme tidig i skolan! åååh vad jag älskar mitt liv just nu!

svinkallt

Idag ser det faktiskt så ruggigt ut, att jag inviger mössan, nu måste jag kila! :) PUSS

fun game

"Jag svär, du spelar spelet bra, du måste bara ge mig en chans att vinna snart innan la ger upp."



help?!

nu är det så att jag har beslutsångest! fick ju ett presentkort av pappa på åhléns, fick cirka 3000:- och har bara köpt massa småsaker eftersom jag inte hittat något och har bara 900 kronor kvar på kortet :bigeyes: så funderar på att antingen ge kortet till mamma så jag får pengar i handen av henne så jag kan köpa löshår(ja, jag blev avis på mettes..:mad: ) eller så behåller jag kortet och köper mig en slags hårtång som gör håret vågigt. Åhh.. jag hatar det här!
löshår eller täng? :(



fredagsmys

två myspys bilder från i fredags som jag precis hittade i wakmans kamera som hon glömt hos mig, mhihi!

a friend is someone who is there when others disappear

Jag saknar Mette :blush:

har det bra

hur mysigt har inte jag?

?!

kan ni gissa vem den här är? Jag eller mette? ;)

hehehehe

Jag har varit brunett? funderar starkt på att färga igen i vinter, fast inte lika mörkt:) eller..?

ingen data....

hej på er! har inte haft en data förns nu:( ledsen! men nu är jag igång igen! Kom precis hem till ÖVERBY! (till dig som störde dig på att jag skrev värmdö, varför skulle jag skämmas över att bo här ute i paradiset? ;) )

var e wakman?

Har inte hört någe från Wakisen på hela dagen.. kan bero på att
1. Min mobil är död och jag har ingen laddare så jag kan inte höra av mig.
2. Hennes data är här, så hon kan inte blogga eller någe, stackarn!
3. jadu, de måste vara 1 eller 2, för 3 finns de ingen!

du suger

I will forever smile when i look back at yah, just couse i know i'm a ahed of you

från wakman till mette

Kolla vilket fint armband jag fick av wakisen i förrgår, hon e best!


photoshop, best friend in the world

Sofia om KUKEN:
Varför har du photoshoppat bilden? Du är ju naturligt vacker mette!


Det är lite bara för att jag kan, skulle man kunna säga.. Ser ja någe jag inte e nöjd med, why not fix it? Föresten skulle jag aldrig photoshoppa en bild ;)




KUKEN

jag vet inte vad ja skriva. jag är galet sliten. min kamera startar inte. godnatt.





småfisar

sandra om kalasbra:
tja, hur gamla är ni?



Både jag och Wakman är tro det eller ej, födda år 1994.. Man skulle kunna tro att vi båda är aningen äldre, men det är vi inte thihi! Om ni inte tror mig lägger ja upp en bild på legget!



citat


"-do not understand why I always get so incredibly in love with all people, will I ever be able to attach myself to one?"



kalasbra

Hej på er, här kommer lite dåliga mobilkamaera bilder bara för att visa hur jag har de, kvalitebilder får ni imorgon puss!












vill också..

.. säga ett stort jävla grattis till våran fina vän TEODOR (LOO)! grattis på 19 års dagen!!!!
Om ett år kommer du ha mig och mette efter dig, glöm inte det ;)


hi

hej på er! har ni haft en rolig fredag? ;) det hade iallafall jag! käkade gott och hade mycket gott sälskap! fick till och med med mig Nicklas! :)

Nu ska jag äta min macka och mitt te! hare bra tjaaaa


en bild


Jag kommer aldrig sluta dra mig till dig.. det är kört för din del.

som sagt

Sa som sagt att jag troligtvis skulle hinna byta om ett antal gånger och ja, nu är jag ombytt och har på mig kvällen outfit nummero dos!

tack tjejor

Vill bara utbringa ett stort jävla TACK till dessa underbara tjejor som tvingades umgås med mig igår, mot dess viljor! :))

Vill såklart tacka alla andra som kunde komma på middagen osv, ursäkta för de vart så stressigt alltihop osv hade skittrevligt och de hoppas ja att ni också hade!

look of the day

 

Kommer troligtvis se ut ungefär såhär ikväll... dock inte säkert eftersom jag har en och en halv timma kvar till ja ska gå, kan hända att ja byter om, en och annan gång

 


<3

Bella om Hihi <3:
Personen är bara avundsjuk!
Du har sjukt fina tänder och tycker både du och mette ser sjukt bra ut :)Avis
Jag bara älskar er gott folk! Kommentarer som dessa värmer verkligen, Bella du e bäst!

en bild


tjosan

Fyfan, mår som man förtjänar idag asså! Orkar inte skriva just nu, dessutom glömde jag kameran igår så har inte en jävla bild från gårkvällen.. "/

06:35

nu drar vi mot bussen mina vänner! hörs sen :)
kisses

i sängen

Hej på er, nu har jag och Wakis precis hoppat ner i sänger, vilket var på tiden. Vi har en lång dag framför oss imorgon PUSS sålänge!

djuröhäng

 

Anne  (anno1000@hotmail.com) om hej jag har tråkigt:

Stockholms skärgård? Tycker du det är pinsamt att säga att du bor på djurö?!


Tror faktiskt inte det handlar om att det på någe vis är pinsamt att bo på djurö det är trotts allt stockholms dyraste bostadsområde.. tror det handlar mer om att vi har så pass många läsare som, mer eller mindre hotar oss, för att vi bland annat ser bättre ut osv, som vill åt oss, därför kan vi inte tala om så tydligt vart vi bor. tragiskt men sant.


Jag bara älskar att hänga här ute på djurö!




borde ja för er skull?

Nej om ja skulle ta Wakman i armhålan och kuta ner till gymmet någon timme.. Sola, och styrke träna lite va säger ni? Skulle kunna blir rätt saftiga bilder till er ;)
eller?



Hihi <3

Anonym om sorry babes:
dina tändar ser hemska ut

heey babe! Ser mina tänder hemska ut? hahahahaahhaha! om det är någon som har fina raka tänder är det fan jag;) skicka in en bild på dina fina tänder och visa hur dom ska se ut då:D skulle vara kul att se faktiskt, en massa farstapussar <3

kitty

köpte liiiiite godis till ikväll, kolla vilken ursöt liten låda man fick till! hello kitty!!







(hon köpte godiset endast för man fick hello kitty lådan -.-)



HÅR

Hey på er, var hos Irga och sydde in mitt förlängsningshår idag, jag är så JÄVLA nöjd! helt sinnes, kunde inte blivit bättre! Kolla hur naturligt det ser ut!
Jävlar va snygg jag är nu, akta er fan!

ny kategori!

har lagt till en ny kategori som jag kallar "Wakman's stylistlektioner" där skriver jag vad jag gör för kul i salongen in tha school och mina egna små knep :)
how fun?!

home

Tudelu, åt lite sushi efter skolan tillsammans med min efterlängtade Wakman, skriver mer snart när jag har tid med er :)

sorry babes

hey gubbar och gummor! vi har inte hunnit blogga idag pga all planering och all shopping.. Men nu är vi tillbaka;)
kom precis hem till Mette och packade upp matvarorna fort som tusen sen upp till mettes place för att blogga!

hey baberiba

bara jag som tycker dom ska börja med hey baberiba igen? så jäävla kul! har kollat på den här (med min stora förebild) tuusen gånger! I LOVE VICTORIA SILVESTEDT

ojdå

I mettes förra inlägg så länkade hon till en grym blogg som är riktigt poppis eller vad man ska säga! men vet ni vad? Jag har faktiskt sminkat ena tjejen där med hennes vän som också är min vän Michaela Brandröv:)
här är lite bilder :)
här är frillan vi gjorde på henne, det är endast hennes riktiga hår!
snyggt vaa

veckans inspererande

Förutom de att dem inspererar än så in i helvete pga av dess starka personligheter, dem båda är så sjukt snygga också! Dem får pris av mig som både för mäst inspererande blogg. Jag hittade bloggen för bara ett par dagarna sedan med hjälp av tipps från en vän, och redan nu är jag fast. Det är en av de bloggarna jag kollar in dagligen så tänkte bara dela med mig av detta till mina underbara läsare!

För att komma till deras blogg klicka här

hate you al

Hej på er, har haft arslet FULLT idag, kom hem senare än jag trodde osv osv.. Nu är jag hur trött som hälst, satt på bussen och tänkte på massa grejjer ja kunde göra till bloggen ikväll, men jag är rädd för att ja inte är på humör just nu.. SRY!  Nu duschar ja och så får vi se om jag orkar med er sen! PUSS

packa!

dags att börja packa! sover eventuellt hos mette imorgon efterrsom vi ska planera lite hemliga grejer ;)
och ta er lugnt! jag känner mig mycket kryare :D

hahaha, jag dör

'

hej jag har tråkigt

01. Fullständigt namn: Amanda

02. Ålder: 17
03. Vart bor du: Stockholms skärgård & sollentuna
04. Bor tillsammans med: mamma, Jonas, bror och ibland Pappa, Diana och Donna. 
05. Husdjur: 3 katter, 1 hundar
06. Färg på ditt hus: rött

07. När är du född: 14 augusti

08. Klass: tvåan
09. Vilket år tar du studenten: next year..

10. Något jobb: nej, jag övar mig som en Hollywoodfru.
11. När gick du upp i morse: 07:30........
12. När ska du sova: när ja blir trött?
13. Duschat idag: nä, men badat har jag! 
14. Kramat någon idag: nej :(

15. Pussat någon idag: nej :(( 
16. Vad har du ätit idag: Bananer, makaroner, mackor,nudlar, mer mackor osv.....
17. Dagens klädsel: morgonrock
18. Dagens smink: inget alls :)

19. Dagens sötnos: Inte är det då jag iallafall.

20. Dagens roligaste: ...

21. Har du många vänner: klarT

22. Hur många har du kysst: flera miljarder
23. Vem kramade du senast: orkar inte tänka.

24. Vem saknar du: Nicklas och Mette!

27. Har du pojk-/flickvän: ja
28. Vem pratade du med i telefon senast: Nicklas
29. Vem fick du senast sms ifrån och vad stod det: Nicklas, "vad heter det där sjuka sångsaken?"


FAVORIT:

31. Film: Felon.

32. Låt: jätte många !!
33. Mat: oxfelé

34. Dryck: Saft!
35. Färg: rosa

36. Tv-serie: desperata husfruar ;)

37. Stad: Vet ej
38. Land: Thailand
39. Ämne i skolan: Ingenting
40. Tv program: hollywoodfruar!


SENASTE:
41. Personen du tänkte på: vet inte...

42. Personen du pussade: Nicklas

43. Gången du spydde: hum, länge sen!

44. Gången du grät: vet inte, ett tag sen iaf

45. Pizzan du åt: någon vecka sen.

46. Gången du var i Göteborg: förra sommarn

47. Gången du var i Stockholm: ?
48. Gången du duschade: badade nyss
49. Gången du sov: inatt
50. Personen som såg dig gråta: tror det va Mette.

51. Svart eller vitt: Vitt
52. Hund eller katt: båda
53. Ut och festa eller hemma och mysa: båda

54. Tvspel eller datorspel: tvspel
55. Singel eller upptagen: upptagen
56. Pussas eller kramas: båda
57. Lunarstorm eller helgon eller Playahead: inget av det.. men för några år sen skulle jag lätt svarat playahead.
58. Ragga eller bli uppraggad: Bli uppraggad
59. Big Brother eller Paradise Hotel: inget!
60. Har du svart hår eller blondt: blont just nu

61. Har du blåa ögon eller bruna: grön/bruna

62. Choklad eller lakrits: lakrits

63. Göteborg eller Stockholm: Stockholm
64. Högerhänt eller vänsterhänt: Högerhänt 
65. Coca cola eller fanta: Cola 
66. Pizza eller kebab: inget!
67. Randigt eller prickigt: randigt
68. Älska eller älskas: båda
69. Leva eller dö: leva

 

ANTAL:
70. Personer du älskar: många, familjen, vänner osv!

71. Personer du hatar: finns väl någon kanske
72. Pojk-/flickvänner du haft: ett seriöst
73. Personer du sovit bredvid, både tjej och kille: Ingen aning!

74. Glassar du ätit på en dag: det e nog många, riktigt många!
75. Nämn en festival du vill på nästa år: peace and love igen!

 

 


12:02

vaknade runt 8 när mamma åkte till jobbet.. jippiiii :bigeyes: så jag satte mig framför tvn och kollade på vakna med the voice där mange makers var med! haha :D Så det var lite kul att kolla på faktiskt, dom var rätt blyga och svarade mest korta svar bara på frågorna men vafafan! jag skulle också vara skit nervös, man ska både fokusera på att vara snygg (eftersom man är med i tv) och se till inte att inte få någon såndär nervös röst (som jag alltid får när någon ropar på mig) Ni vet när man låter som Justin Bieber gör nu? haha, där satt den!

hejdå för en stund

Hej på er, är alldeles överlycklig, för jag fått "sova ut" en morgon mitt i veckan, asskönt! Nu ska jag springa ner och äta frulle sedan åka iväg till skolan, för en dag av organisation och ledarskap, idrott och så tänkte jag åka till staden och göra ett hemligt ärende efterskolan, VAD, får ni se om ett par dagar med lite tur! ;)

Kontaktannons

Nu jävlar brudar, kommer det en riktigt nice "kontaktannons" som jag just lockade till mig.. Blir aningen svartsjuk då jag ens delar med mig av honom, men som jag redan berättat är förhållande inget för mig!




Här har ni Victor Berulf, hur jävla snygg som hälst!
Victor är 19 år och bor i Stockholm. Han arbetar som ?profissionell trissskapare? och på fritiden gillar han att dricka öl har han talat om. Han tycker att det är viktigt att även mannen får chans ge i ett förhållande.
Tror ni Victor är killen i era drömmar kan ni klicka här, för att kontakta honom. Lycka till nu tjejer, först i kvar med skönast charm som vinner!


sovmorgon

Hej på er, kom precis hem från träningen, hade asnice träning idag med 96 laget, tackar verkligen för att dem vill spela med oss.. annars hade vi inte vart någonting haha!  (vi är för få, inte dåliga på någe vis)
När jag kom hem möttes ja iallafall av en sådan enorm lycka, då jag kom på att jag inte börjar förns halv tolv imorgon SUG PÅ DEN! HAH!  nu hoppas ja in i duschen vi hörs!
(bild från alanya, åh jag vill tillbaka!)



angry

Men gud jag blir så arg på den där vikingen som sitter i idoljuryn!! Alexander eller vad han heter(?)
Ens stunden säger han att han inte alls kränker folk, men vad sitter han och gör?!
-han säger till den där extremt läskiga bruden att hon hör hemma på ett spökhus eller vad nu det var.
Det kanske hon gjorde..? Hennes näsa var ju helt grön, såg ni det?!
Nej, men man kan vara elak på ett lite roligare sätt? Man behöver inte hoppa på folks utseénde och säga sådär.
Och allt skit ska ju komma från snubben som ser ut som en nötknäckare.


räddare i nöden.

har precis pratat med underbara mette på skype. Vi planerade våran fredag :love: gud så kul det ska bli! Men innan jag gör någonting så ska jag fokusera på att ta ett varmt bad, knarka kan jang+ annan medicin, dricka grönt te med honung i och bara sova sova soooova!

karl <3

Jag bara älskar Karl Kagerfeld's egna designade colaflaskor! Sökte runt lite på google för att se om man kunde beställa hem några, men precis som jag trodde så gör det ju inte de..:thumbdown: Skulle lätt ha köpt alla om det gick!


baraenbild


höst

Fick till en riktigt höstig outfit idag.. Vad tycker ni?

Tänktill

tänkte börja med en liten ny liten grej att varje gång jag sätter in den här roliga bilden ska jag skriva in:
  • vad jag stör mig på.
  • släppa ut min ilska.
  • Tankar.
  • frågor till er bloggläsare.
OSV! :D
xoxo

lycklig

Hej på er, sitter och lyssnar på "next to you med Justin Bieber och Chris brown", och känner mig alldeles nykär. Låten, vädret, solen bara allt ihop känns så jävla bra just nu! Sakna min underbara Wakman dock, tänkte kolla med henne om vi kanske kunde ta en bio på typ torsdag när jag slutat, det är ju inge vidare ansträngade så det lär hon väll palla trotts hennes förkylning!

ungefär såhär lycklig är jag nu, som Mauritius i vintras. Åh vad jag vill tillbaka!



15:11

Hej babes! just nu känner jag mig lite på TPL humör, men det går nog över när jag blir frisk!! :mad: Aja, nu får jag sluta gnälla om min förkyldning, tycker ni inte? Jag hatar när folk gnäller, jag ska sluta. Jag lovar! ;)

somchords


11:45

hola! ligger och kollar på topmodel fast ett lite nyare avsnitt än igår..haha. Idag händer nog lika mycket som igår tråkigt nog, nu vill jag bara bli frisk och pigg igen! jag hatar det här.

-.-

Förjävla dåligt väder idag.. knappt att jag kunde gå upp ur sängen imorse alltså.. fyfan!
Ni får ursäkta dålig bildkvalite men jag hinner inte på någe annat vis. Nu måste ja ner och koka välling vi hörs!

komigennu

har precis tagit lite bilder, hehe. take a look vettja!

hej

Påmin mig allesammans att jag har en massa roligheter att visa er senare.. Eller beror på vad man tycker är kul ioförsig.. Har en massa nya grejjer jag vill visa er, kanske ska säga så istället! ;))

FET DISS

(färgtatueringar)
Det kan vara något av det fulaste som finns.. och försök inte kom och säg att din är speciel, den blir inte snyggare för de.. fyfan! Det enda tatueringsformen jag gillar överhuvudtaget, är text.. text, text och bara text!

how cute?

Såhär mysigt hade jag det igår då jag inte hade tid med er läsare.. Jag svär en dag ska ja skaffa mig en egen det var det sötaste jag någosin sett!

finaly


11:32

ligger i soffan med en stor kopp te och tycker synd om mig själv. Det finns ingenting på tv förutom ett avsnitt av topmodell från 2006... woho!!!!! Plus att jag är lika sjukt som igår, fast nu har jag börjar hosta också! åh vilken gnällspik jag är.

-.-

Tudelu mina underbara, sitter i skolan.. suger -.- Har datakunskap hela dagen mellan 8-14 -.-
hör av mig när jag kommer hem TJO!


19:36

Efter regn kommer solsken och då kutar jag ut med kameran i högsta hugg!!


snutt

Kolla vilket fint armband jag fick av Nillas när han kom hem! älskar det verkligen!
Nu kan ni ju samtidigt kolla in min tattoo som absolut inte var meningen att synas överdrivet mycket på bilden;)
hjerta

Movietime

ska lägga mig och kolla på 13 snart 30, haha! sjuuukt länge sen jag såg den filmen. Kommer ihåg att jag älskade den sjukt mycket iallafall:)

host*

Hoppade precis ur ett underbart,varmt och mysigt bubbelbad! låg där i minst en timme, hihi.
Hur skönt ser inte det här ut att vara? hade såklart med mig min sterio också så jag kunde lyssna på favorit stationen The voice;)

http://....

veckans snyggaste blogg blir nog...
www.undins.blogg.se!!!
bloggen ägs av en tjej som heter Veronika som har en super snygg design! visst är den?!
och så här söt är hon:)
FEEEET LÄÄÄÄÄÄÄÄÄNK :D

Grattis

Jag kommer kanske vara med i miss teen i september nästa år? hur sjukt är inte det? fick ett mail om att jag ska ha ett möte med dom då. NU har jag något att se fram emot!

tack!

fick en parfym av mamma idag, kan inte känna hur den luktar men den luktar säkert gudomligt;)
tack mor!

12:39

kul att jag har blivit dunderförkyld! :( jag orkar inte!! Jag som skulle åka och shoppa idag, men så blev det ju inte. Stannar säkert hemma imorgon och tar det lugnt, käkar lite soppa och knarkar vitaminer!
ha det grymt så hörs vi sen

Morning

Vaknade nyss på grund av att Mettes mobil ringde, sedan hör jag henne sucka och säga " jag hatar mcdonalds.."
Så hon ska åka till jobbet vid halv 1 idag. Stackare :(

operation

Tänkbara operationer i min framtid, vad tycker ni?!
Inte helt omöjligt att detta genomförs en dag..

nails

åh, hejdå underbara sommarnaglar...

gluggen

gud vad trött jag blir ibland! jag blir så t.r.ö.t.t på allt och alla. Nu känner jag att både jag och mette är lite tpl, men vi är trötta, sura och irriterade.
fråga inte varför taaackkkkkk

fu.

Ville bara hoppa in och fråga "vem fan tror du att du är?"

yesturday

Hej på er, nu jävlar ska ni få uppdatering kan jag lova, se och njut! ;)

hejsvejs

Hej, har precis kollat film.. vi hade för mycket att välja på ikväll så vi sket i allt, hyrde en film och spelade allmänt svårfångade! :))

hey you

Hej på er.. Var inte hemma förns åtta imorse så har inte vart assnabba idag asså, hinner inte blogga nu heller eftersom vi snart ska vidare på nya äventyr vi hörs!

aja,,

hej babes! hur mår ni? -jag och mette mår som prinsessor, fast vi var ute hela natten/morgonen! ;) Snart ska vi åka mot Åhléns city för att shoppa lite grejer till mig! Fick ju mitt efterlängtande presentkort av pappa & Diana igår! happyface!!!
2 bilder från igår :)
en jätte söt amanda... & Mette :D
Mattiiis!!

dagens:


Lasange

26 minuter kvar innan min lasange ska ut ur ugnen, guud vad hungrig jag är! Pratade precis med Mette i tele och kom fram till att vi ska slå klackarna i taket ikväll;) så det gäller att äta en hel del innan vi går ut, får hoppas att pappa har köpt mitt presentkort idag så jag kan åka och köpa lite partykläder :D

SV:

Sara om kolla..:
Kan du inte snälla lägga upp fler bilder på skorna! Skulle vilja se hur de sitter på osv! Var köpte du dom och hur mycke fick du betala? 

Tack på förhand hatar er blogg btw!!!!!!!!!
SV: hej korvis! Absolut! köpte dom på christians egna hemsida för cirka 6000:-. FETT VÄRT! JAG ÄR SÅ JÄ*LA KÄR!!!!
Och du, kul att du hatar våran blogg men ändå läser :D det är det här vi vill! DU är underbar! :D
;)

hos nillas

sitter hos nicklas och väntar tills han ska komma hem! Idag så har jag inte gjort någonting alls förutom skolan då.. Men det är ju som att inte göra ett skit! aja, ha det braaa så hörs vi! kisses
just nu!

ennattsomgurrapack

Hej på er, är i gustavsberg nu och ska snart dra iväg för att jobba.. -.- Eftersom jag inte är hemma kan jag tyvär inte dela med mig av några roliga bilder, jag är verkligen super ledsen över det.. Blir kvar i gustavsberg över natten så det är bara hålla tummarna för att Wakman uppdaterar er en massa under dagen/kvällen! Vi hörs senare, nu ska jag vara lite social och inte bara sitta vid datan!



Hoppas denna bild duger.. Tråkigt för er som har mig på facebook eftersom det är min nuvarande profilbild.. -.-


school

Nu är vi (jag och Elin) ready, för att åka iväg till schoolan, hörs sen! :))

RSS 2.0